Aberrant R-loop-induced replication stress in MED12 mutant uterine fibroids

Patients and samples

This study was approved by the institutional review board of UT Health San Antonio. MM and UF samples were collected from patients (n = 12) providing informed consent and undergoing hysterectomy. MM and UF tissues from 10 patients were described previously13 and used for tissue microarray (TMA) generation, while MM and UF tissues from 2 additional patients were used for primary cell cultures. Demographic and clinicopathological information for all 12 patients in the current study is provided in Supplementary Table S1.

Cell culture

Immortalized uterine smooth muscle cells (UtSMCs) have been described52 and were cultured in DMEM / F12 (GIBCO) with 10% fetal bovine serum and 1% antibiotic – antimycotic (Invitrogen) at 5% CO2. Primary MM and UF cells were similarly cultured in DMEM / F12 (GIBCO) with 10% fetal bovine serum and 1% antibiotic – antimycotic (Invitrogen) at 5% CO2 and processed for DNA fiber analysis (see below) within 3 days of initial plating .

Tissue micro array and immunohistochemistry

Matched MM and UF (MED12 mutation-negative and MED12 mutation-positive) tissues from 10 patients were used for TMA generation. A board-certified pathologist (Dr. Robert Reddick, UT Health San Antonio) reviewed the hematoxylin – eosin-stained sections cut from formalin-fixed, paraffin-embedded tissue blocks for all patients and identified regions for creation of TMAs that included fibroids and normal adjacent myometrium. The TMAs were constructed as previously described53. Tissue cores with a diameter of 2 mm were punched from each specimen in triplicate and arrayed into a recipient paraffin block. The template used to produce the TMAs was designed using randomized samples within the template to avoid artifacts caused by technical problems. TMA slides consist of 30 tissue sections including 10 individual patient-matched sample sets, each set comprising MM, as well as MED12 mutation-negative UF and MED12 mutation-positive UF tissues, all derived from the same patient uterus. Orientation markers were added to the template for correct alignment.

Immunohistochemistry was performed on the TMA slides using a Ventana XT Immunostainer with I-View DAB detection, which uses an avidin – biotin detection system. Secondary antibody alone was used on off cuts of tissue microarray slides as a negative control. Slides were stained with antibodies specific for proteins of interest, including S9.6 (AB-2687463; Kerafast), and Mybiosource Antibodies pRPA (MBS2534546), RPA (MBS2534546), pATR (MBS9608121), ATR (MBS9612974), pCHK1 (MBS9600779) , CHK1 (MBS767885), pCD25A (MBS9201824), CDC25A (MBS629584), γH2AX (MBS9412572), pATM (M128339), ATM (MB2535445), p53BP1 (MBS9413890). Slides were scanned using the Aperio ScanScope® CS system (Leica Microsystems GmbH, Wetzlar, Germany) with a 40 × objective lens. The histologic parameters were evaluated using Aperio ImageScope software (version 12.3.2.8013; Leica Microsystems). Individual nuclei and nuclear and cytoplasmic localization of protein of interest were identified using the default algorithm built into the ImageScope software. The quantified intensity was normalized to the number of nuclei of the sections in the TMA slides.

Generation of stable RNaseH-expressing uterine smooth muscle cell line

A lentiviral V5-tagged WT RNaseH1-expressing plasmid was generated from ppyCAG_RNaseH1-WT (addgene # 111,906)54 and LVR-1003-MCS-PGK-BSD (Cellomics Technology). Briefly, the coding sequence (CDS) for C-terminally V5-tagged WT RNase H1 (carrying a nuclear localization signal) was PCR-amplified from ppyCAG_RNaseH1-WT using primers containing EcoRI and BamHI restriction enzyme digest sites. Following agarose gel PCR product purification (QIAquick gel Extraction Kit, Qiagen), WT RNase H1-V5 CDS was subcloned into LVR-1003-MCS-PGK-BSD with EcoRI and BamHI restriction enzymes to generate lentiviral WT RNase H1-V5 plasmid. A second-generation lentiviral system was used to generate WT RNase H1-V5 expressing lentivirus. Briefly, VSV-G envelope-expressing, psPAX2 packaging (addgene plasmids # 12,260 and # 12,259; a generous gift from D. Trono), and lentiviral WT RNase H1-V5 transfer plasmids were transfected into HEK293T cells using X-treme Gene HP DNA Transfection Reagent (Millipore, Sigma). Twenty-four hrs post-transfection, HEK293T culture medium was replaced with DMEM supplemented with 10% FBS and pen / strep antibiotics (Invitrogen). Twenty-four hrs later, the viral supernatant was collected and concentrated at 26,000 rpm for 1 h and 45 min in an Optima L-100 XP Ultracentrifuge (Beckman Coulter). Thereafter, lentivirus was snap-frozen in liquid nitrogen and stored at -80 ° C. Immortalized UtSMCs were used to generate a stable line expressing WT RNase H1-V5. Briefly, 70% confluent UtSMCs were transduced with WT RNase H1-V5 lentivirus supplemented with 2 μg / mL of polybrene. Twenty-four hrs post-transduction, culture media was replaced with the culture media containing 2 μg / mL of Blasticidin (BSD) selectable marker. WT RNase H1-V5 (hereinafter simply RNaseH) -expressing cells were selected with BSD for one week. Expression of WT RNase H1-V5 was validated by immunoblot analysis with V5-specific antibody.

Immunofluorescent staining

UtSM and UtSM-RNAseH overexpressing cells were plated in PerkinElmer cell carrier imaging 96- well plates at a density of 4000–5000 cells / well. Cells were treated with vehicle (DMSO) control, CCT254515 (100 nm), or Camptothecin (10 mM) for the times indicated in each individual experiment. Cells were fixed with 4% paraformaldehyde and processed for immunofluorescent detection as described earlier55 and imaged in a single focal plane at × 40 magnification using an Operetta imaging system. Using Columbus ™ (PerkinElmer) software, the protein intensity in the cytoplasm and nucleus were quantified. The nucleus was defined by DAPI staining (Thermo Fisher Scientific) and processed for further analysis.

MED12 mutation analysis

Total DNA was isolated form the myometrial and fibroid tissue using QuickExtract DNA Extraction Solution (Lucigen), according to the manufacturer’s instruction. Following total DNA extraction, genomic region containing UF-linked MED12 mutations was PCR amplified with the following primers: MED12-F: GCCCTTTCACCTTGTTCCTT and MED12-R: TGTCCCTATAAGTCTTCCCAACC. PCR product was gel purified using QIAquick Gel Extraction Kit (Qiagen), according to manufacturer’s instructions, and Sanger Sequenced by Genewiz, (NJ, USA).

Primary cell isolation and culture

Primary cells were isolated as described56. Briefly, MM and UF tissues were diced manually into small pieces of <1 mm3 which were then incubated overnight (16-18 h) in DMEM / F12 (GIBCO) containing 0.2% (wt / vol) collagenase (Wako), 0.05% DNase I (Invitrogen), 1% antibiotic – antimycotic mixture (Invitrogen), 10 % FBS and 10 mM Hepes buffer solution (Invitrogen) at 37 ° C on a shaker. After shaking, the digested tissue was filtered through a sterile 100-μm polyethylene mesh filter to remove undigested tissues, and again filtered through a 40-μm cell strainer (BD – Falcon). The filtrates were treated with ACK lysis solution for 10 min at room temperature, centrifuged and washed with 1X HBSS to remove red blood cells. Live cells were counted and seeded in 10 cm dishes (250,000cells / dish) with DMEM / F12 (GIBCO) with 10% fetal bovine serum and 1% antibiotic – antimycotic (Invitrogen) at 5% CO2. Primary cell cultures were processed within 3 days of plating for DNA fiber analysis.

DNA fiber analysis

Primary MM and UF cells were labeled with 50 μM IdU (Sigma-Aldrich I-7125) followed by 100 μM CldU (Sigma-Aldrich C-6891) for 30 min each as described previously57. UtSM and UtSM-RNaseH expressing cells were treated with 100 nM CCT254515 for 2 h in between Idu and Cldu treatments. Briefly, ~ 300,000 cells were embedded in agarose and DNA was prepared then combed onto silanized coverslips using the FiberComb® Molecular Combing System (Genomic Vision). Following combing, coverslips were baked for 2 h at 65 ° C, dehydrated in ethanol (70% -90% -100%, 3 min each), then denatured with 0.5 M NaOH + 1 M NaCl for 8 min at room temperature. Coverslips were neutralized with PBS (3 min wash, 3 times), subjected to a graded ethanol series as described above and air-dried. Combed DNA was blocked with BlockAid Blocking Solution (Invitrogen B10710), followed by immunostaining with antibodies specific for IdU (mouse anti-BrdU, BD Biosciences 347,580) and CldU (rat, anti-BrdU, Abcam ab220074) for 1 h at 37 ° C , washed with PBS-T, and probed with secondary antibodies (anti-mouse, Cy3, SIGMA C2181 and anti-rat, AF488, Invitrogen A11006) for 45 min at 37 ° C. Single-stranded DNA was counterstained with anti-ssDNA mouse antibody (DSHB University of Iowa) for 2 h at 37 ° C, followed by anti-mouse BV480 (Jackson Immuno Research 115–685-166) for 45 min at 37 ° C. Coverslips were washed in PBS, subjected to a graded ethanol series, air-dried and then mounted. Images were obtained using a 40 × oil objective on a Nikon Swept field confocal microscope. The number of stalled forks, new forks, bidirectional forks, and their lengths were measured using Image J. To calculate fork velocity, the following equation was used to convert fork length from μm to kb / min: length μm × 2.59 / labeling time in min = fork velocity kb / min.

Cell cycle and proliferation analyzes

For cell cycle analyzes, UtSM and UtSM-RNaseH expressing cells (3 × 105) were seeded in 15-cm plates and cultured for 24 h before the addition of DMSO or CCT254515 (100 nM) for an additional 72 h. Cells were trypsinized with 0.05% Trypsin – EDTA, centrifuged for 10 min at 1000 RPM, 4 ° C and washed with 1 mL 1 × PBS three times. Thereafter, cells (1 × 106) were fixed with 70% ethanol at 4 ° C overnight. Fixed cells were centrifuged for 5 min at 2800 RPM at 4 ° C. After ethanol removal, the cells were treated with 40 μg / mL of Propidium Iodide and 0.1 μg / mL of RNaseA in 1 × PBS and incubated for 30 min at 37 ° C. Stained cells were filtered through a cell strainer and incubated on ice before FACS analysis. Cell cycle analysis was performed on BD FACSCalibur and data analyzed using Flowjo software. For proliferation assays, UtSM and UtSM-RNaseH expressing cells (1 × 104) were seeded in 6-well plates and cultured for 24 h before addition of DMSO or CCT254515 (100 nM). Cells were harvested at 48, 96, and 144 h post treatment, stained with 0.4% trypan blue, and manually counted on a hemocytometer. All experiments were performed in triplicate.

Immunoblot analysis

Validation of target engagement and kinetics of Mediator kinase inhibition by CCT251545 in UtSMCs was performed by immunoblot analysis of STAT1 as described previously33 using antibodies specific for total (SC-464; Santa Cruz Biotechnology) and phosphorylated (Ser727) (# 9177; Cell Signaling Technology) STAT1.

Statistical analysis

Statistical testing was performed using Graph Pad Prism 9. One way ANOVA followed by post Hoc test was used to calculate significance. For the other experiments, a two-sided unpaired Student’s t-test was calculated. Significance was assumed where p-values ​​≤ 0.05. Asterisks represent significance in the following way: ****p≤ 0.0001, ***p≤ 0.001; **p≤ 0.01; *p≤ 0.05.

All methods were carried out in accordance with relevant guidelines and regulations.

Leave a Reply

Your email address will not be published.

Back to top button